CYTOTOUR

CytoTour › Worksheets › Protein synthesis

Protein synthesis worksheet: transcription and translation

A free, printable worksheet for high school and AP Biology. Students follow a real human gene — β-globin (HBB) — from DNA to protein, then see how one changed base causes sickle-cell hemoglobin.

Download the PDF (free)Answer key (Teacher plan)

What's inside

  1. Vocabulary (10 terms)
  2. Transcription and RNA processing (8 questions)
  3. Translation (6 questions)
  4. From gene to protein: β-globin (2 questions)
  5. Compare the two processes (1 task)

Teach it with the 3D lesson

Every question matches a step in CytoTour's 3D chapters on transcription and translation, built from real molecular structures. Read the steps with pictures on transcription and translation, step by step, or project the lesson in class — Chapter 1 is free, and the Teacher plan opens every chapter.

The worksheet

This is the printable sheet (18 questions). Printing this page prints only the worksheet.

CytoTour · cytotour.com · free to print and copy for your classes

Protein synthesis: transcription and translation

NameDatePeriod

Part 1 · Vocabulary

1. Write the letter of the matching description next to each term.

  1. Promoter
  2. Template strand
  3. RNA polymerase II
  4. Exon
  5. Intron
  6. Spliceosome
  7. 5' cap
  8. Codon
  9. Anticodon
  10. Ribosome
  1. AMachine of rRNA and proteins that links amino acids in the order the mRNA codes
  2. BComplex of proteins and small nuclear RNAs that removes introns
  3. CThree tRNA bases that base-pair with a codon
  4. DPart of the pre-mRNA that is cut out in the nucleus before translation
  5. EEnzyme in the nucleus that makes all protein-coding pre-mRNAs
  6. FDNA sequence near the start of a gene where transcription factors and RNA polymerase bind to start transcription
  7. GPart of a gene that stays in the mature mRNA after splicing
  8. H7-methylguanosine added to the RNA's 5' end; protects it and helps ribosomes recognize it
  9. IThe one DNA strand that is read to choose each base of the new RNA
  10. JThree mRNA bases that specify one amino acid or a stop

Part 2 · Transcription and RNA processing

2. In which direction does RNA polymerase build a new RNA strand?

  1. A3'→5', reading the template 5'→3'
  2. B5'→3', reading the template 3'→5'
  3. C5'→3', reading the template 5'→3'
  4. DIn both directions at once

3. In a eukaryotic cell, where does transcription happen? Where does translation happen?

4. A template DNA strand reads 3'-TACGGA-5'. Write the mRNA made from it, 5'→3'.

5. The first three codons of HBB's coding sequence have the template strand 3'-TAC CAC GTA-5'. Write the mRNA they code for, 5'→3'.

6. Besides splicing, name the two changes made to the ends of the pre-mRNA before it leaves the nucleus, and give one job of each.

7. Introns begin with the bases ______ and end with the bases ______.

8. The HBB gene spans 1,608 nucleotides from the start site to the end of exon 3. How long is its mature mRNA, not counting the cap and poly-A tail?

  1. A1,608 nt
  2. B980 nt
  3. C628 nt
  4. D444 nt

9. Put the start of HBB gene expression in order. Number them 1–5.

  1. DNA at the start site is unwound (transcription bubble)
  2. RNA is made 5'→3' from the template strand
  3. The finished mRNA leaves through a nuclear pore
  4. TFIID (with TATA-binding protein) binds the promoter
  5. RNA polymerase II binds, forming the initiation complex

Part 3 · Translation

10. How many codons are there in the genetic code, and how many of them specify amino acids? Write the three stop codons.

11. In which direction does the ribosome read the mRNA? Which end of the polypeptide is made first?

12. Codon 2 of the β-globin mRNA is GUG. Which amino acid will the next tRNA bring into the A site?

  1. AMethionine
  2. BValine
  3. CGlutamate
  4. DHistidine

13. Match each ribosome site with what happens there.

  1. A site
  2. P site
  3. E site
  1. AReleases the empty tRNA
  2. BA charged tRNA arrives
  3. CHolds the tRNA with the growing chain

14. What catalyzes the formation of each peptide bond in the ribosome?

  1. AAn aminoacyl-tRNA synthetase
  2. BRNA in the large subunit (the ribosome is a ribozyme)
  3. CThe mRNA
  4. DThe release factor

15. An mRNA reads 5'-AUG UUU GGC UAA-3'. How many amino acids does the ribosome add?

Part 4 · From gene to protein: β-globin

These are the first 7 codons of the human β-globin gene (HBB), the gene changed in sickle-cell disease.

16. Fill in the template strand, the mRNA and the amino acids (three-letter abbreviations; use a codon chart).

Codon 1Codon 2Codon 3Codon 4Codon 5Codon 6Codon 7
Coding strand (DNA) 5'→3'ATGGTGCATCTGACTCCTGAG
Template strand (DNA) 3'→5'
mRNA 5'→3'
Amino acid

17. In sickle-cell hemoglobin, codon 7 of the coding strand changes from GAG to GTG. Write the new mRNA codon and the amino acid it codes for. What kind of mutation is this?

Part 5 · Compare the two processes

18. Complete the table.

TranscriptionTranslation
Where (in eukaryotes)
What is read
What is made
Main machine